packaging plasmid pspax2 (Addgene inc)
Addgene inc is a verified supplier 
98
Structured Review
Addgene inc
packaging plasmid pspax2
Packaging Plasmid Pspax2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 15580 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pspax2/psPAX2+(Plasmid+%2312260)/pmc13651853-251-12-16
Average 98 stars, based on 15580 article reviews
Packaging Plasmid Pspax2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 15580 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pspax2/psPAX2+(Plasmid+%2312260)/pmc13651853-251-12-16
Average 98 stars, based on 15580 article reviews
packaging plasmid pspax2 - by Bioz Stars,
2026-10
98/100 stars
Images
Related Articles
Virus:Article Title: Crosstalk between NUAK1 and the SETD1A complex regulates glycolysis and gluconeogenesis upon glucose deprivation. Article Snippet: Briefly, single-guide RNA (sgRNA) sequences targeting SETD1A (GTCCTTGGGGCCAGAGATACAGG) were cloned into the lentiCRISPR v2 vector (Addgene, #52961). .. HEK293T cells were co-transfected with the sgRNA-containing lentiCRISPR v2-SETD1AsgRNA (for SETD1A-KD virus) or empty LntiCRISPR v2 vector (for control-KD virus shown in Fig. S2), Plasmid Preparation:Article Title: Crosstalk between NUAK1 and the SETD1A complex regulates glycolysis and gluconeogenesis upon glucose deprivation. Article Snippet: Briefly, single-guide RNA (sgRNA) sequences targeting SETD1A (GTCCTTGGGGCCAGAGATACAGG) were cloned into the lentiCRISPR v2 vector (Addgene, #52961). .. HEK293T cells were co-transfected with the sgRNA-containing lentiCRISPR v2-SETD1AsgRNA (for SETD1A-KD virus) or empty LntiCRISPR v2 vector (for control-KD virus shown in Fig. S2), Article Title: The gene-regulatory evolution of the human skeleton. Article Snippet: .. In brief, 50,000 cells per cm2 HEK293T cells were seeded in T175 flasks and cultured for 48 h. The cells were co-transfected with (per flask) 7.5 μg of plasmid libraries, 2.5 μg of pMD2.G (Addgene, 12259) and 5 μg of Article Title: TRAM promotes Toll-like-receptor-free myddosome signal transduction. Article Snippet: Plasmid transfections were performed by using a 10× mix in Opti-MEM I reduced serum medium (31985062, Thermo Fisher Scientific) containing DNA plasmids and Lipofectamine 2000 transfection reagent (11668019, Thermo Fisher Scientific) at a 1:2 ratio according to the manufacturer’s instructions. .. For lentiviral packaging, HEK293T cells were transfected with equimolar ratios of the transfer plasmid, pMD2.G (Addgene, 12259) and Article Title: An IgG-like fusion protein comprising an anti-spike S2 antibody and ACE2 exhibits potent and broad neutralization against SARS-CoV-2 and variants of concern Article Snippet: .. HEK293T cells were transfected with a plasmid mixture of Control:Article Title: Crosstalk between NUAK1 and the SETD1A complex regulates glycolysis and gluconeogenesis upon glucose deprivation. Article Snippet: Briefly, single-guide RNA (sgRNA) sequences targeting SETD1A (GTCCTTGGGGCCAGAGATACAGG) were cloned into the lentiCRISPR v2 vector (Addgene, #52961). .. HEK293T cells were co-transfected with the sgRNA-containing lentiCRISPR v2-SETD1AsgRNA (for SETD1A-KD virus) or empty LntiCRISPR v2 vector (for control-KD virus shown in Fig. S2), Transduction:Article Title: Curved adhesions resist disruption by high-affinity αv-integrin inhibitors. Article Snippet: Article Curved adhesions resist disruption by high-affinity αv-integrin inhibitors Transfection:Article Title: Curved adhesions resist disruption by high-affinity αv-integrin inhibitors. Article Snippet: Article Curved adhesions resist disruption by high-affinity αv-integrin inhibitors Article Title: The gene-regulatory evolution of the human skeleton. Article Snippet: .. In brief, 50,000 cells per cm2 HEK293T cells were seeded in T175 flasks and cultured for 48 h. The cells were co-transfected with (per flask) 7.5 μg of plasmid libraries, 2.5 μg of pMD2.G (Addgene, 12259) and 5 μg of Article Title: TRAM promotes Toll-like-receptor-free myddosome signal transduction. Article Snippet: Plasmid transfections were performed by using a 10× mix in Opti-MEM I reduced serum medium (31985062, Thermo Fisher Scientific) containing DNA plasmids and Lipofectamine 2000 transfection reagent (11668019, Thermo Fisher Scientific) at a 1:2 ratio according to the manufacturer’s instructions. .. For lentiviral packaging, HEK293T cells were transfected with equimolar ratios of the transfer plasmid, pMD2.G (Addgene, 12259) and Article Title: An IgG-like fusion protein comprising an anti-spike S2 antibody and ACE2 exhibits potent and broad neutralization against SARS-CoV-2 and variants of concern Article Snippet: .. HEK293T cells were transfected with a plasmid mixture of Cell Culture:Article Title: The gene-regulatory evolution of the human skeleton. Article Snippet: .. In brief, 50,000 cells per cm2 HEK293T cells were seeded in T175 flasks and cultured for 48 h. The cells were co-transfected with (per flask) 7.5 μg of plasmid libraries, 2.5 μg of pMD2.G (Addgene, 12259) and 5 μg of Construct:Article Title: Taxane-induced conformational changes in the microtubule lattice activate GEF-H1-dependent RhoA signalling. Article Snippet: pLenti-RhoA2G42 was a gift from O. Pertz (Addgene 40179), FLAG-aTAT132 was a gift from S. Etienne-Manneville (Institut Pasteur, Paris, France), VASH2-FLAG and SVBP-FLAG were a gift from M. Martin (University of Brussels, Belgium), and HA-MATCAP58 was a kind gift from T. Brummelkamp (Netherlands Cancer Institute, Amsterdam, the Netherlands). .. Generated:Article Title: Disrupted copper homeostasis promotes osteopontin-mediated hepatocyte-stellate cell crosstalk in Wilson disease. Article Snippet: .. Lentiviral particles were generated using the lentiCRISPR v2 system (Addgene #52961) together with |